galaxybork
galaxybork galaxybork
  • 01-03-2018
  • Mathematics
contestada

the last answer I got for this was not help full. Please help. Will give brainliest.

the last answer I got for this was not help full Please help Will give brainliest class=

Respuesta :

lujainalaydie2 lujainalaydie2
  • 01-03-2018
suppose JJ = Jhalil , J = Joman

1 - JJ 860 J620

2 - JJ 870 J 670

3- JJ880 J 720

4- JJ890 J 770

5- JJ900 J 820

6- JJ910 J 870

7- JJ920 J 920 - Catched up

8- JJ 930 J 970

9- JJ940 J 1020

10- JJ 950 J 1070

11- JJ960 J 1120

12- JJ 970 J 1170

so a - week 7

b- Joman 

Answer Link

Otras preguntas

Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
where are the three parts of an atom located
Help pl0x, Algebra 1
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
What was George Washington's nickname?
Please help with Algebra 1