Seudónimo Seudónimo
  • 02-09-2015
  • Mathematics
contestada

Are the equations 3x - -9 and 4x - -12 equivalent? Explain.
Please Help!!

Respuesta :

kiyahbaby11
kiyahbaby11 kiyahbaby11
  • 02-09-2015
no because  when  you do 3*--9 = 27 and 4*--12 =48

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
why is the square root of a perfect square always rational
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Please help solve, thanks in advance!
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.