shorty8815 shorty8815
  • 03-10-2017
  • Mathematics
contestada

The sum of two numbers is 68 . the smaller number is 12 less than the larger number. what are the numbers?

Respuesta :

aiuanna
aiuanna aiuanna
  • 03-10-2017
The larger number is 56 because if you do 68-12=56
Answer Link

Otras preguntas

How many years does an apple tree live useful?
what is the lcd of 10/11,29/44
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how can you write 0.45 as fraction and a percentage ,please show work
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic