bellerz bellerz
  • 03-03-2017
  • Mathematics
contestada

How to find it to the nearest cent

How to find it to the nearest cent class=

Respuesta :

Аноним Аноним
  • 03-03-2017
the answer would be $600

Answer Link

Otras preguntas

Joey is trying to prove that CATS is an isosceles trapezoid. He starts by providing that line segment AT is parallel to line segment CS and that line segment AS
Which is closest to the value of w in the triangle below?
A spaceship launched into the air has a height (feet) at any given time (seconds) as h=-t^2+10t until it hits the ground. At what time(s) is it at a height of 9
What do you think it means when someone says “words come out to play”?
Which deal is better 20 for $8 or 30 for $10
why would establishing an agricultural college be a way to enhance a country's rate of development?​
A certain company's main source is a mobile app. The function h models the company's annual profit (in million of dollars) as a function of the price they charg
can someone help me with this
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
8 Complete the conversation with the correct form of the appropriate verb. venir salir traer dar decir poner Ana: Félix, tú sabes que hoy una fiesta para Elena.