KingstenG622957 KingstenG622957
  • 03-11-2022
  • Mathematics
contestada

Which formula is used to determine the standard normal random variable (Z)?

Which formula is used to determine the standard normal random variable Z class=

Respuesta :

LamarrA205772 LamarrA205772
  • 03-11-2022

The standard normal random variable Z can be calculated using the formula:

[tex]Z=\frac{x-\mu}{\sigma}[/tex]

Where x is the input, μ is the mean and σ is the standard deviation.

Therefore the correct option is the first one.

Answer Link

Otras preguntas

Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
31+34=90-n 45+1=70-k 6×9=41+m
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which system of government would states function independently of each other?
why did Mr Collins come to the Bennet family looking for a wife?
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
the table shows the elevation of 6 cities in CaliforniaCity                                                               ElevationWestmorland
define concentric circles
Step by step directions Square root for 480