daianablanco
daianablanco daianablanco
  • 03-05-2021
  • Mathematics
contestada

please help me solve this , is for tomorrow​

please help me solve this is for tomorrow class=

Respuesta :

hc25631 hc25631
  • 03-05-2021

Answer:

-96

Step-by-step explanation:

This is the right answer.

Answer Link

Otras preguntas

20% of what number is equal to 2/3 of 90?
who is the present president of liberia
what is r in this equation? πr^2=42π
What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Hor
The vessels that are responsible for carrying blood away from the heart are
Why did some americans feel that the united states should help europe after world war ii?
Write one or two sentences about the main idea or purpose of the article.
_______________ exposure to radiation can increase the risk of cancer.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
An employee working in a machine shop is exposed to three different sources which emit noises at 81 dB, 91 dB, and 88 dB. What is the combined noise level expos