18salaufey 18salaufey
  • 02-02-2021
  • Mathematics
contestada

What single percentage change is equivalent to a 9% increase followed by a 14% decrease?

Respuesta :

reguser315
reguser315 reguser315
  • 02-02-2021
Assume the number 100. 100*1.09=109. You then do 109*0.86=93.74.

So the overall decrease is 6.26%.
Answer Link

Otras preguntas

the table shows the elevation of 6 cities in CaliforniaCity                                                               ElevationWestmorland
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
why is it critical to your cells to be near capillaries
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What does hemostasis mean?
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
what is the lcd of 10/11,29/44