michelleyanezg01 michelleyanezg01

03-12-2020
Mathematics

contestada

A bicyclist goes 45.5 miles in 3.5 hours. What is her speed?

Respuesta :

Аноним Аноним

03-12-2020

Answer:

13 mph

Step-by-step explanation:

45.5/3.5 = 13

Answer Link

akc0204588 akc0204588

03-12-2020

Answer:

13 mph

Step-by-step explanation:

divide 45.5 by 3.5 to get 13 mph

Answer Link

Otras preguntas

Which are True or False ?

At age 76 years, which chronic condition is elizabeth most likely to have?

Which one of the following choices best represents an appropriate warm-up exercise? A. Toe touches B. Supine leg lifts C. Hip extensions

What was one of the two major goals that the national organization for women work towards when it was first founded?

The incline of a roller coaster is 2 times as long as its elevation, and the horizontal length of the roller coaster is 11 m more than the elevation. what is th

which goal stated in the preamble to the u.s. constitution requires a strong army

Write a compound inequality that the graph could represent.

(60) Points HeLp asap 5 questions

Ashya wants to focus on the diagnosis and treatment of psychological disorders and other problematic patterns of behavior. what area of psychology should she wo

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat