sammrichardson2003 sammrichardson2003

02-06-2020
Mathematics

contestada

The quadrilaterals are similar.

If CB = 6, GF = 3, and CD = 4, find GH.
A) 2
B) 3
C) 8
D) 10

The quadrilaterals are similar If CB 6 GF 3 and CD 4 find GH A 2 B 3 C 8 D 10 class=

Respuesta :

victoria6172 victoria6172

02-06-2020

Answer:

a

Step-by-step explanation:

CB and GF are the same side and u can see that CB is two times larger than GF so GH is two times smaller then CD

Answer Link

Otras preguntas

For some time, the English had little interest in colonizing for what two reasons?

Why did the United States go to war with Britain in 1812

The transtheoretical model includes a stage called termination. a. True b. False

For how many different values of θ between 0 and 2π radians is sec x = csc x ?

What was the result of the anti-nephi-lehies becoming converted unto the lord?

Which type of oscillation would most likely produce an electromagnetic wave?

How would you say good-bye to a friend whom you might not see for a long time? a. Hasta luego. b. Hasta pronto. c. Hasta ahora. d. ¡Adiós! e. Hasta mañana.

"which band was led by guitarist peter buck and vocalist michael stipe?"

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?