dontasktabpe750b dontasktabpe750b
  • 02-10-2018
  • Mathematics
contestada

The sum of 6 times a larger integer and 6 times a smaller integer is 60. The difference between 4 times the larger and 6 times the smaller is 30. Find the integers

Respuesta :

Аноним Аноним
  • 02-10-2018

The answers are 9 and 1.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How would you describe neville chamberlain's policy toward hitler in the late 1930?
Find the missing length indicated
A string of lights contains three lights. the lights are wired in series, so that if any light fails the whole string will go dark. each light has probability .
How do you find the length of the hypetnyuse if you have one angle and opposite side?
Which order pair could be removed so that the set of ordered pairs is a function (4,-2) (-3,2) (3,4) (1,1)
What does this passage suggest about truman's reasons for declaring his doctrine? he thinks the doctrine is necessary to protect the united states as well as ot
Why was the Neolithic revolution important
Which of the following is not a characteristic of African music? A. A wide range of indigenous instruments B. Strong harmonic structures C. Complex rhyt
Do you think social mobility is an easy thing to achieve in the US? Why or why not?