laurbensimon laurbensimon
  • 01-09-2018
  • Mathematics
contestada

a math test contained 18 questions. julie answered 15 correctly. what % of her answers were correct?

Respuesta :

kaitiepass
kaitiepass kaitiepass
  • 01-09-2018
That gives you the fraction of 15/18. Divide that and multiply by 100 for the percent. The answer would be 83.3%.
Answer Link
zrh2sfo
zrh2sfo zrh2sfo
  • 01-09-2018

(100/18)*15 = 83.3333333333%

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why did the french revolution happen and who's fault was it
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
what was paul revere failures
A vehicle is only 15% efficient. What happened to the other 85%?
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God